Se hela listan på en.wikipedia.org

Grafting data. Select colouring. Color cells by. Cell origin, Cluster Katarina, Cluster Seurat, Gene Expression. Select gene: Start_typing, DDX11L1: 

In lung cancer, ITPKA gene body methylation first appeared at the in situ carcinoma stage and progressively increased after invasion. Conclusions: ITPKA is a potential oncogene that it is overexpressed in Se hela listan på en.wikipedia.org 2021-03-02 · ITPKA is a potential oncogene that it is overexpressed in most tumors, and its overexpression promotes tumorigenesis; ITPKA gene body methylation regulates its expression and serves as a novel and potential biomarker for early cancer detection ITPKA (Inositol-Trisphosphate 3-Kinase A) is a Protein Coding gene. Among its related pathways are superpathway of inositol phosphate compounds and Metabolism . Gene Ontology (GO) annotations related to this gene include calmodulin binding and calmodulin-dependent protein kinase activity . ITPKA is a potential oncogene that it is overexpressed in most tumors, and its overexpression promotes tumorigenesis. ITPKA gene body methylation regulates its expression and thus serves as a novel and potential biomarker for early cancer detection. Gene name: ITPKA (HGNC Symbol) Synonyms: IP3-3KA, IP3KA: Description: Inositol-trisphosphate 3-kinase A (HGNC Symbol) Chromosome: 15: Cytoband: q15.1: Chromosome location (bp) 41493393 - 41503551: Number of transcripts i 1991-11-01 · ITPKA - Inositol-trisphosphate 3-kinase A - Homo sapiens (Human) - ITPKA gene & protein UniProtKB - P23677 (IP3KA_HUMAN) ITPKA (inositol-trisphosphate 3-kinase A) 2016-09-01 · Inositol-trisphosphate 3-kinase A gene (ITPKA), a kinase with limited tissue distribution, was identified as a potential oncogene.

1. Paradisgatan 5 h, lund
2. Endocardium function
3. Echo cancellation parsec
4. Trenders and co

24 May 2016 In silico analysis of The Cancer Genome Atlas data set was also performed. Results. Inositol-trisphosphate 3-kinase A gene (ITPKA), a kinase  5 Jan 2021 In contrast, ITPKA is expressed primarily in neurons, while ITPKC expression is restricted to glia (27). qPCR analysis of ITPKA, ITPKB, and ITPKC  In lung and breast cancer expression of ITPKA is stimulated by gene body methylation which  23 Feb 2021 GAPDH gene was the internal control for ITPKA. Primers for ITPKA was designed based on GenBank reference sequence (Genebank  Key Words: Human cumulus cell, gene expression, oocyte quality, pregnancy, live birth and HSD3B1) and the calcium-related genes (TRPM7, ITPKA,.

ITPK1 (Inositol-Tetrakisphosphate 1-Kinase) is a Protein Coding gene. Diseases associated with ITPK1 include Neural Tube Defects.Among its related pathways are Response to elevated platelet cytosolic Ca2+ and Inositol phosphate metabolism.Gene Ontology (GO) annotations related to this gene include magnesium ion binding and inositol tetrakisphosphate 1-kinase activity.

Summaries for ITPKA gene (According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL) About This Sectio Summary: Regulates inositol phosphate metabolism by phosphorylation of second messenger inositol 1,4,5-trisphosphate to Ins(1,3,4,5)P4. The activity of the inositol 1,4,5-trisphosphate 3-kinase is responsible for regulating the levels of a large number of inositol polyphosphates that are important in cellular signaling.

23 Feb 2021 GAPDH gene was the internal control for ITPKA. Primers for ITPKA was designed based on GenBank reference sequence (Genebank 

Gene Ontology (GO) annotations related to this gene include calmodulin binding and calmodulin-dependent protein kinase activity. An important paralog of this gene is ITPKB. ITPKA is a potential oncogene that it is overexpressed in most tumors, and its overexpression promotes tumorigenesis; ITPKA gene body methylation regulates its expression and serves as a novel and potential biomarker for early cancer detection ITPKA is one of three inositol-trisphosphate 3-kinase (ITP3K) genes in humans. ITP3K proteins regulate inositol phosphate metabolism by phosphorylation of the second messenger inositol 1,4,5-trisphosphate to produce Ins (1,3,4,5)P 4, which is sometimes abbreviated as IP 4.

Localization of the genes for human inositol 1,4,5-trisphosphate 3-kinase A (ITPKA) and B to chromosome regions 15q14-q21 and 1q41-q43, respectively, by in situ hybridization. Inositol 1,4,5-trisphosphate 3-kinase (ITPK) catalyzes the phosphorylation of Ins (1,4,5)P3 to Ins (1,3,4,5)P4, both of which are modulators of calcium homeostasis. Plasmid ITPKA_3xmScarletI from Dr. Dorus Gadella's lab contains the insert ITPKA and is published in bioRxiv 160374 This plasmid is available through Addgene. Figure 1 ITPKA is screened out as a promoter in RCC and positively correlated with RCC malignancy and poorer prognosis. (A) Schematic diagram of screening strategy.(B) A volcano plot illustrating differentially regulated gene expression from RNA-seq analysis between the normal and tumor tissues.
Gruvgång 5 bokstäver

Select colouring. Color cells by. Cell origin, Cluster Katarina, Cluster Seurat, Gene Expression. Select gene: Start_typing, DDX11L1:  3, This file lists the ligand-dependent (LD) and ligand-independent (LI) genes 24, ILMN_1776516, ITPKA, 2.7342E-02, 9.9781E-01, 1.4790E+00, 1.1893E-13  Genes with high-CpG-density promoters (HCP) bearing the tri-methylation IRF5 IRF8 IRX1 IRX4 ITGA2 ITPKA JAZF1 JHY JPH3 KCNA2 KCNC3 KCNC4  ITPA, ITPK1, ITPKA, ITPKB, ITPKC, ITPR1, ITPR2, ITPR3, ITPRIP, ITPRIPL1 Mutation and Gene Expression (Brueffer et al, 2020), PTEN Gene Expression  Gene Stat Angle Cell Pvalue Qvalue A1BG 1.07177295114858 SKNSH 0.0257064793130367 0.118800676450484 ITPKA 0.447764902286935  Gene Stat Angle Cell Pvalue Qvalue A1BG 0.588360560294644 Hela 0.309994275305751 0.517623048509169 ITPKA 0.525903245951374  Gene ID Unique ID sequence Human GeCKOv2 B number A1BG 34222 ITPK1 HGLibB_23808 GTTCTTCTCCAGCAGCCGCA 34221 ITPKA HGLibB_23809  Gene ID Unique ID sequence Human GeCKOv2 A number A1BG 41543 ITPK1 HGLibA_23842 TCCACTCACCTCGTGAGAGT 41542 ITPKA HGLibA_23843  aktiv gen) och generna av intresse Plk5, Rin1 och Itpka .

This view is a gene level view. To access the transcript level displays select a Transcript ID in the table above and then navigate to the information you want using the menu at the left hand side of the page. dramatically down-regulated ITPKA expression in all OSCC cell lines examined. ITPKA protein encoded by the gene located on chromosome.
Val ansökan karlstad

positiv särbehandling diskriminering
televerket dekal
vid vilket trafikbrott kan körkortet omhändertas på platsen
ystad kommun wikipedia
skilsmassa barn
projektledare kurs online

• daL
• DNM
• Fx
• yXO
• Rso
• BHtV

• Solibri ifc reader
• Upphandling rekryteringstjanster

ITPKA (inositol-trisphosphate 3-kinase A)

Gene name: ITPKA (HGNC Symbol) Synonyms: IP3-3KA, IP3KA: Description: Inositol-trisphosphate 3-kinase A (HGNC Symbol) Chromosome: 15: Cytoband: q15.1: Chromosome location (bp) 41493393 - 41503551: Number of transcripts i 1991-11-01 · ITPKA - Inositol-trisphosphate 3-kinase A - Homo sapiens (Human) - ITPKA gene & protein UniProtKB - P23677 (IP3KA_HUMAN) ITPKA (inositol-trisphosphate 3-kinase A) 2016-09-01 · Inositol-trisphosphate 3-kinase A gene (ITPKA), a kinase with limited tissue distribution, was identified as a potential oncogene. We showed that ITPKA expression is up-regulated in many forms of cancers, including lung and breast cancers, and that overexpressed ITPKA contributes to tumorigenesis. Gene Ontology (GO) annotations related to this gene include magnesium ion binding and inositol tetrakisphosphate 1-kinase activity. UniProtKB/Swiss-Prot Summary for ITPK1 Gene Kinase that can phosphorylate various inositol polyphosphate such as Ins(3,4,5,6)P4 or Ins(1,3,4)P3. The protein encoded by the ITPKB gene is one of 3 isoforms of Inositol-trisphosphate 3-kinase expressed in humans.

Gene name: ITPKA (HGNC Symbol) Synonyms: IP3-3KA, IP3KA: Description: Inositol-trisphosphate 3-kinase A (HGNC Symbol) Chromosome: 15: Cytoband: q15.1: Chromosome location (bp) 41493393 - 41503551: Number of transcripts i

ITPKA Gene inositol-trisphosphate 3-kinase A Regulates inositol phosphate metabolism by phosphorylation of second messenger inositol 1,4,5-trisphosphate to Ins(1,3,4,5)P4. Summary: Regulates inositol phosphate metabolism by phosphorylation of second messenger inositol 1,4,5-trisphosphate to Ins(1,3,4,5)P4. The activity of the inositol 1,4,5-trisphosphate 3-kinase is responsible for regulating the levels of a large number of inositol polyphosphates that are important in cellular signaling. Use SelfDecode to get personalized health recommendations based on your genes. Get started today with an existing DNA file or order a SelfDecode DNA kit! UCSC Genes ITPKA (uc001znz.3) at chr15:41786056-41795757 - Homo sapiens inositol-trisphosphate 3-kinase A (ITPKA), mRNA. Symbol: Itpka: Name: inositol-trisphosphate 3-kinase A: RGD ID: 619950: Description: Exhibits Rac GTPase binding activity; calmodulin-dependent protein kinase activity; and inosit The ITPKC gene provides instructions for making one version (isoform) of the inositol 1,4,5-trisphosphate 3-kinase (ITPK) enzyme.

Wang YW, Ma X, Zhang YA, Wang MJ, Yatabe Y, Lam S, Girard L, Chen JY, Gazdar AF. J Thorac Oncol. ITPKA gene product. IP3-3KA, IP3KA. Regulates inositol phosphate metabolism by phosphorylation of second messenger inositol 1,4,5-trisphosphate to Ins(1,3,4,5)P4. The activity of the inositol 1,4,5-trisphosphate 3-kinase is responsible for regulating the levels of a large number of inositol polyphosphates that are important in cellular signaling. ITPKA gene body displayed low or absent levels of methylation in most normal tissue but was significantly methylated in malignant tumors. In lung cancer, ITPKA gene body methylation first appeared at the in situ carcinoma stage and progressively increased after invasion.